Mouse Anti-DNA Recombinant Antibody (clone m3D8) (CAT#: FAMAB-1853CQ)

This product is a recombinant mouse antibody that recognizes DNA. The antibody was purified by affinity chromatography. It can be used in SPR, ELISA.


Specific Inquiry
  • Size:
  • Conjugation:
  • Endotoxin:
  • Purity:
  • Fc Engineering:
  • Datasheet
  • MSDS
  • COA

Specifications

  • Immunogen
  • 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
  • Host Species
  • Mouse
  • Type
  • Mouse IgG1
  • Specificity
  • Single-stranded DNA oligomers
  • Clone
  • m3D8
  • Applications
  • SPR, ELISA

Product Property

  • Purity
  • >95% as determined by SDS-PAGE
  • Concentration
  • Please refer to the vial label for the specific concentration.
  • Storage
  • Centrifuge briefly prior to opening vial. Store at +4°C short term (1-2 weeks). Aliquot and store at -20°C long term. Avoid repeated freeze/thaw cycles.

Target

  • Alternative Names
  • Deoxyribonucleic acid

Product Notes

This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including:

• Increased sensitivity
• Confirmed specificity
• High repeatability
• Excellent batch-to-batch consistency
• Sustainable supply
• Animal-free production

See more details about Hi-Affi™ recombinant antibody benefits.

Downloads

Download resources about recombinant antibody development and antibody engineering to boost your research.

See other products for "Clone m3D8"

See other products for "DNA"

Mouse Antibody

CAT Product Name Application Type
PABX-048 Recombinant Mouse Anti-DNA Antibody WB, ELISA, FuncS IgG
PABX-048-F (E) Recombinant Mouse Anti-DNA Antibody Fab Fragment WB, ELISA, FuncS Fab

Humanized Antibody

CAT Product Name Application Type
PABX-048-S (P) Recombinant Mouse Anti-DNA Antibody scFv Fragment WB, ELISA, FuncS scFv

Customer Reviews and Q&As

Submit a review or a question
There are currently no Customer reviews or questions for FAMAB-1853CQ. Click the button above to contact us or submit your feedback about this product.
View the frequently asked questions answered by Creative Biolabs Support.

For Research Use Only. Not For Clinical Use.

For research use only. Not intended for any clinical use. No products from Creative Biolabs may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative Biolabs.

Send Inquiry

This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.

© 2024 Creative Biolabs.
  • 0
  • 0
Cart

    Go to compare