Mouse Anti-DNA Antibody (clone m3D8), mRNA
CAT#: FAMAB-1853CQ-mRNA
This mRNA encodes a Mouse antibody against DNA. It contains two mRNAs that encode for the heavy and light chains of the antibody.
Specifications
- Immunogen
- 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
- Host Species
- Mouse
- Specificity
- Single-stranded DNA oligomers
- Clone
- m3D8
Product Property
- Purity
- >95%
- Storage
- Store at -20°C.
Target
- Alternative Names
- Deoxyribonucleic acid
Customer Review
There are currently no Customer reviews or questions for FAMAB-1853CQ-mRNA. Click the button above to contact us or submit your feedback about this product.
Submit Your Publication
Published with our product? Submit your paper and receive a 10% discount on your next order! Share your research to earn exclusive rewards.
Downloadable Resources
Download resources about recombinant antibody development and antibody engineering to boost your research.
Product Notes
This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including:
• Increased sensitivity
• Confirmed specificity
• High repeatability
• Excellent batch-to-batch consistency
• Sustainable supply
• Animal-free production
See more details about Hi-Affi™ recombinant antibody benefits.
Datasheet
MSDS
COA
Certificate of Analysis LookupTo download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
See other products for "Clone m3D8"
- CAT
- Product Name
See other products for "DNA"
Select a product category from the dropdown menu below to view related products.
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABL-074 | Mouse Anti-DNA Recombinant Antibody (PABL-074) | ELISA, WB, FuncS | Mouse IgG |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABL-075 | Mouse Anti-DNA Recombinant Antibody (clone ED10) | ELISA, WB, FuncS | Mouse IgG |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PSBL-074 | Mouse Anti-DNA Recombinant Antibody; scFv Fragment (PSBL-074) | ELISA, WB, FuncS | Mouse scFv |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PSBL-075 | Mouse Anti-DNA Recombinant Antibody (clone ED10); scFv Fragment | ELISA, WB, FuncS | Mouse scFv |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PFBL-074 | Mouse Anti-DNA Recombinant Antibody; Fab Fragment (PFBL-074) | ELISA, WB, FuncS | Mouse Fab |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PFBL-075 | Mouse Anti-DNA Recombinant Antibody (clone ED10); Fab Fragment | ELISA, WB, FuncS | Mouse Fab |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABW-032 | Recombinant Mouse Anti-DNA Antibody (ED10) | WB, ELISA | IgG |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABC-033 | Mouse Anti-DNA Recombinant Antibody (clone 64M-2) | ELISA, WB | Mouse IgG |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABL-451 | Mouse Anti-DNA Recombinant Antibody (clone A52) | ELISA, WB, FuncS | Mouse IgG |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PFBW-032 | Recombinant Mouse Anti-DNA Antibody Fab Fragment (ED10) | WB, ELISA | IgG |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PFBC-033 | Mouse Anti-DNA Recombinant Antibody (clone 64M-2); Fab Fragment | ELISA, WB | Mouse Fab |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PFBL-448 | Mouse Anti-DNA Recombinant Antibody (clone A52); Fab Fragment | ELISA, WB, FuncS | Mouse Fab |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PSBC-033 | Mouse Anti-DNA Recombinant Antibody (clone 64M-2); scFv Fragment | ELISA, WB | Mouse scFv |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PSBL-448 | Mouse Anti-DNA Recombinant Antibody (clone A52); scFv Fragment | ELISA, WB, FuncS | Mouse scFv |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABX-048 | Recombinant Mouse Anti-DNA Antibody | WB, ELISA, FuncS | IgG |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABX-048-S (P) | Recombinant Mouse Anti-DNA Antibody scFv Fragment | WB, ELISA, FuncS | scFv |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| PABX-048-F (E) | Recombinant Mouse Anti-DNA Antibody Fab Fragment | WB, ELISA, FuncS | Fab |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| FAMAB-0086-YC-S(P) | Mouse Anti-DNA Recombinant Antibody (clone H149); scFv Fragment | ELISA, IF | Mouse scFv |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| MOR-A1364-YJ | Mouse Anti-DNA Recombinant Antibody (clone ET844.3.1) | ELISA | Mouse IgM |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| VS-1124-YJ33 | Mouse Anti-DNA Recombinant Autoantibody (clone G5-8) | ELISA | Mouse lgG2b lambda |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| VS-1124-YJ34 | Mouse Anti-DNA Recombinant Autoantibody (clone G4-20) | ELISA | Mouse IgG2a kappa |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| VS-1124-YJ35 | Mouse Anti-DNA Recombinant Autoantibody (clone G3-47) | ELISA | Mouse IgG2a kappa |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| VS-1124-YJ37 | Mouse Anti-DNA Recombinant Autoantibody (clone G1-5) | ELISA | Mouse IgG2a kappa |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| VS-1124-YJ39 | Mouse Anti-DNA Recombinant Autoantibody (clone G6-23) | ELISA | Mouse lgG2b lambda |
| CAT | Product Name | Application | Type |
|---|---|---|---|
| VS-0325-FY165 | Human Anti-DNA (clone 71F12) scFv-Fc Chimera | ELISA, IF | Human IgG1, scFv-Fc |
Popular Products

Application: FC, Cyt, Stim, PP, Agonist

Application: IF, IP, Neut, FuncS, ELISA, FC, WB

Application: Neut, ELISA, IF, IP, FuncS, FC, ICC

Application: IF, IP, Neut, FuncS, ELISA, FC, ICC

Application: ELISA, FC, IF, WB
-4.jpg)
Application: FC
For research use only. Not intended for any clinical use. No products from Creative Biolabs may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative Biolabs.
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.




-2.png)








-3.jpg)




