Mouse Anti-DNA Antibody (clone m3D8), mRNA (CAT#: FAMAB-1853CQ-mRNA)
This mRNA encodes a Mouse antibody against DNA. It contains two mRNAs that encode for the heavy and light chains of the antibody.
We specialize in custom recombinant antibody production, offering seamless execution from provided sequences to high-quality antibody deliverables, ensuring optimal yield and purity.
Specifications
- Immunogen
- 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
- Host Species
- Mouse
- Specificity
- Single-stranded DNA oligomers
- Clone
- m3D8
Product Property
- Purity
- >95%
- Storage
- Store at -20°C.
Target
- Alternative Names
- Deoxyribonucleic acid
Product Notes
This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including:
• Increased sensitivity
• Confirmed specificity
• High repeatability
• Excellent batch-to-batch consistency
• Sustainable supply
• Animal-free production
See more details about Hi-Affi™ recombinant antibody benefits.
Downloads
Download resources about recombinant antibody development and antibody engineering to boost your research.
See other products for "Clone m3D8"
See other products for "DNA"
Select a product category from the dropdown menu below to view related products.
CAT | Product Name | Application | Type |
---|---|---|---|
PFBL-074 | Mouse Anti-DNA Recombinant Antibody; Fab Fragment (PFBL-074) | ELISA, WB, FuncS | Mouse Fab |
PFBL-075 | Mouse Anti-DNA Recombinant Antibody (clone ED10); Fab Fragment | ELISA, WB, FuncS | Mouse Fab |
FAMAB-0075CQ-F(E) | Mouse Anti-DNA Recombinant Antibody (clone 16-13); Fab Fragment | ELISA | Mouse Fab |
FAMAB-0076CQ-F(E) | Mouse Anti-DNA Recombinant Antibody (clone 1A11); Fab Fragment | ELISA | Mouse Fab |
FAMAB-0077CQ-F(E) | Mouse Anti-DNA Recombinant Antibody Fab Fragment (FAMAB-0077CQ-F(E)) | ELISA | Mouse Fab |
Customer Reviews and Q&As
There are currently no Customer reviews or questions for FAMAB-1853CQ-mRNA. Click the button above to contact us or submit your feedback about this product.
Popular products with customers
Application: Neut, ELISA, IF, IP, FuncS, FC, ICC
Application: Neut, ELISA, IF, IP, FuncS, FC, ICC
Application: WB, ELISA, IP, FC, FuncS, Neut, IF
Application: FC, IP, ELISA, Neut, FuncS, IF, WB
Application: FuncS, IF, Neut, ELISA, FC, IP, IHC
Application: FC, IHC, FuncS, Inhib, Cyt
Application: FuncS, IF, Neut, ELISA, FC, IP, ICC
Application: ELISA, FC, IP, FuncS, IF, Neut, ICC
Application: IP, IF, FuncS, FC, Neut, ELISA, IHC
Application:
Application: WB, ELISA
Application: FC, IB, Block, Inhib, FuncS, ELISA, FACS, IP, IF
Application: SPR, Inhib, FuncS
Application: Neut
Application: ELISA, Block, WB, FC, IP
Application: ELISA, Inhib, FuncS
For Research Use Only. Not For Clinical Use.
For research use only. Not intended for any clinical use. No products from Creative Biolabs may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative Biolabs.
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.