Mouse Anti-DNA Antibody (clone m3D8), mRNA (CAT#: FAMAB-1853CQ-mRNA)

This mRNA encodes a Mouse antibody against DNA. It contains two mRNAs that encode for the heavy and light chains of the antibody.

Specific Inquiry
  • Size:
  • Datasheet
  • MSDS
  • COA

Specifications

  • Immunogen
  • 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
  • Host Species
  • Mouse
  • Specificity
  • Single-stranded DNA oligomers
  • Clone
  • m3D8

Product Property

  • Purity
  • >95%
  • Storage
  • Store at -20°C.

Target

  • Alternative Names
  • Deoxyribonucleic acid

Product Notes

This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including:

• Increased sensitivity
• Confirmed specificity
• High repeatability
• Excellent batch-to-batch consistency
• Sustainable supply
• Animal-free production

See more details about Hi-Affi™ recombinant antibody benefits.

Downloads

Download resources about recombinant antibody development and antibody engineering to boost your research.

See other products for "Clone m3D8"

See other products for "DNA"

Select a product category from the dropdown menu below to view related products.
Please select product type
ScFv Antibody Products Fab Antibody Products Mouse Antibody Products Humanized Antibody Products IgG Antibody Products IgM Antibody Products Autoantibody Products ScFv-Fc Chimera Products

Customer Reviews and Q&As

Submit a review or a question

There are currently no Customer reviews or questions for FAMAB-1853CQ-mRNA. Click the button above to contact us or submit your feedback about this product.

Popular products with customers


For Research Use Only. Not For Clinical Use.

For research use only. Not intended for any clinical use. No products from Creative Biolabs may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative Biolabs.

Send Inquiry

This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.

  • 0
  • 0
Cart
    Go to compare

    Go to compare