Mouse Anti-DNA Antibody (clone m3D8), mRNA

CAT#: FAMAB-1853CQ-mRNA

This mRNA encodes a Mouse antibody against DNA. It contains two mRNAs that encode for the heavy and light chains of the antibody.

Specifications

  • Immunogen
  • 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
  • Host Species
  • Mouse
  • Specificity
  • Single-stranded DNA oligomers
  • Clone
  • m3D8

Product Property

  • Purity
  • >95%
  • Storage
  • Store at -20°C.

Target

  • Alternative Names
  • Deoxyribonucleic acid
REVIEWS AND Q&AS CITATIONS RESOURCES DOWNLOADS RELATED PRODUCTS
Inquiry
Navs

Customer Review

Submit a review or a question

There are currently no Customer reviews or questions for FAMAB-1853CQ-mRNA. Click the button above to contact us or submit your feedback about this product.

Submit Your Publication

Published with our product? Submit your paper and receive a 10% discount on your next order! Share your research to earn exclusive rewards.

Article title:
DOI/PubMed URL:
Email:
Name:

This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.

Downloadable Resources

Download resources about recombinant antibody development and antibody engineering to boost your research.

Product Notes

This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including:

• Increased sensitivity
• Confirmed specificity
• High repeatability
• Excellent batch-to-batch consistency
• Sustainable supply
• Animal-free production

See more details about Hi-Affi™ recombinant antibody benefits.

Datasheet

MSDS

COA

Certificate of Analysis Lookup

To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.

Lot Number:

See other products for "Clone m3D8"

See other products for "DNA"

Select a product category from the dropdown menu below to view related products.

CAT Product Name Application Type
PABL-074 Mouse Anti-DNA Recombinant Antibody (PABL-074) ELISA, WB, FuncS Mouse IgG
CAT Product Name Application Type
PABL-075 Mouse Anti-DNA Recombinant Antibody (clone ED10) ELISA, WB, FuncS Mouse IgG
CAT Product Name Application Type
PSBL-074 Mouse Anti-DNA Recombinant Antibody; scFv Fragment (PSBL-074) ELISA, WB, FuncS Mouse scFv
CAT Product Name Application Type
PSBL-075 Mouse Anti-DNA Recombinant Antibody (clone ED10); scFv Fragment ELISA, WB, FuncS Mouse scFv
CAT Product Name Application Type
PFBL-074 Mouse Anti-DNA Recombinant Antibody; Fab Fragment (PFBL-074) ELISA, WB, FuncS Mouse Fab
CAT Product Name Application Type
PFBL-075 Mouse Anti-DNA Recombinant Antibody (clone ED10); Fab Fragment ELISA, WB, FuncS Mouse Fab
CAT Product Name Application Type
PABW-032 Recombinant Mouse Anti-DNA Antibody (ED10) WB, ELISA IgG
CAT Product Name Application Type
PABC-033 Mouse Anti-DNA Recombinant Antibody (clone 64M-2) ELISA, WB Mouse IgG
CAT Product Name Application Type
PABL-451 Mouse Anti-DNA Recombinant Antibody (clone A52) ELISA, WB, FuncS Mouse IgG
CAT Product Name Application Type
PFBW-032 Recombinant Mouse Anti-DNA Antibody Fab Fragment (ED10) WB, ELISA IgG
CAT Product Name Application Type
PFBC-033 Mouse Anti-DNA Recombinant Antibody (clone 64M-2); Fab Fragment ELISA, WB Mouse Fab
CAT Product Name Application Type
PFBL-448 Mouse Anti-DNA Recombinant Antibody (clone A52); Fab Fragment ELISA, WB, FuncS Mouse Fab
CAT Product Name Application Type
PSBC-033 Mouse Anti-DNA Recombinant Antibody (clone 64M-2); scFv Fragment ELISA, WB Mouse scFv
CAT Product Name Application Type
PSBL-448 Mouse Anti-DNA Recombinant Antibody (clone A52); scFv Fragment ELISA, WB, FuncS Mouse scFv
CAT Product Name Application Type
PABX-048 Recombinant Mouse Anti-DNA Antibody WB, ELISA, FuncS IgG
CAT Product Name Application Type
PABX-048-S (P) Recombinant Mouse Anti-DNA Antibody scFv Fragment WB, ELISA, FuncS scFv
CAT Product Name Application Type
PABX-048-F (E) Recombinant Mouse Anti-DNA Antibody Fab Fragment WB, ELISA, FuncS Fab
CAT Product Name Application Type
FAMAB-0086-YC-S(P) Mouse Anti-DNA Recombinant Antibody (clone H149); scFv Fragment ELISA, IF Mouse scFv
CAT Product Name Application Type
MOR-A1364-YJ Mouse Anti-DNA Recombinant Antibody (clone ET844.3.1) ELISA Mouse IgM
CAT Product Name Application Type
VS-1124-YJ33 Mouse Anti-DNA Recombinant Autoantibody (clone G5-8) ELISA Mouse lgG2b lambda
CAT Product Name Application Type
VS-1124-YJ34 Mouse Anti-DNA Recombinant Autoantibody (clone G4-20) ELISA Mouse IgG2a kappa
CAT Product Name Application Type
VS-1124-YJ35 Mouse Anti-DNA Recombinant Autoantibody (clone G3-47) ELISA Mouse IgG2a kappa
CAT Product Name Application Type
VS-1124-YJ37 Mouse Anti-DNA Recombinant Autoantibody (clone G1-5) ELISA Mouse IgG2a kappa
CAT Product Name Application Type
VS-1124-YJ39 Mouse Anti-DNA Recombinant Autoantibody (clone G6-23) ELISA Mouse lgG2b lambda
CAT Product Name Application Type
VS-0325-FY165 Human Anti-DNA (clone 71F12) scFv-Fc Chimera ELISA, IF Human IgG1, scFv-Fc
Specific Inquiry
Go to compare Add to compare

For research use only. Not intended for any clinical use. No products from Creative Biolabs may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative Biolabs.

Send Inquiry

This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.

Go to compare

Go to compare

Merry Christmas & Happy New Year
Happy Thanksgiving close ad