Mouse Anti-DNA Recombinant Antibody (clone m3D8) (CAT#: FAMAB-1853CQ)
This product is a recombinant mouse antibody that recognizes DNA. The antibody was purified by affinity chromatography. It can be used in SPR, ELISA.
We specialize in custom recombinant antibody production, offering seamless execution from provided sequences to high-quality antibody deliverables, ensuring optimal yield and purity.
Specifications
- Immunogen
- 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
- Host Species
- Mouse
- Type
- Mouse IgG1
- Specificity
- Single-stranded DNA oligomers
- Clone
- m3D8
- Applications
- SPR, ELISA
Product Property
- Purity
- >95% as determined by SDS-PAGE
- Concentration
- Please refer to the vial label for the specific concentration.
- Storage
- Centrifuge briefly prior to opening vial. Store at +4°C short term (1-2 weeks). Aliquot and store at -20°C long term. Avoid repeated freeze/thaw cycles.
Target
- Alternative Names
- Deoxyribonucleic acid
Product Notes
This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including:
• Increased sensitivity
• Confirmed specificity
• High repeatability
• Excellent batch-to-batch consistency
• Sustainable supply
• Animal-free production
See more details about Hi-Affi™ recombinant antibody benefits.
Downloads
Download resources about recombinant antibody development and antibody engineering to boost your research.
See other products for "Clone m3D8"
See other products for "DNA"
Select a product category from the dropdown menu below to view related products.
CAT | Product Name | Application | Type |
---|---|---|---|
PABW-032 | Recombinant Mouse Anti-DNA Antibody (ED10) | WB, ELISA | IgG |
PABC-033 | Mouse Anti-DNA Recombinant Antibody (clone 64M-2) | ELISA, WB | Mouse IgG |
FAMAB-0075CQ | Mouse Anti-DNA Recombinant Antibody (clone 16-13) | ELISA | Mouse IgG2a |
FAMAB-0076CQ | Mouse Anti-DNA Recombinant Antibody (clone 1A11) | ELISA | Mouse IgG2b |
FAMAB-0077CQ | Mouse Anti-DNA Recombinant Antibody (FAMAB-0077CQ) | ELISA | Mouse IgG2a |
Customer Reviews and Q&As
There are currently no Customer reviews or questions for FAMAB-1853CQ. Click the button above to contact us or submit your feedback about this product.
Popular products with customers
Application: FuncS, IF, Neut, ELISA, FC, IP, ICC
Application: ELISA, FC, IP, FuncS, IF, Neut, ICC
Application: IF, IP, Neut, FuncS, ELISA, FC, ICC
Application: ELISA, IHC, FC, IP, IF, FuncS
Application: ELISA, IHC, FC, IP, IF, Inhib
Application: ELISA, WB, FC
For Research Use Only. Not For Clinical Use.
For research use only. Not intended for any clinical use. No products from Creative Biolabs may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative Biolabs.
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.